ABSTRACT

The aim of this research was to determine the presence of Helicobacter pylori virulence genotypes and their association with precursor lesions of gastric malignancy and histological parameters in patients with dyspepsia symptoms in southwestern Colombia. Polymerase chain reaction (PCR) was used for the genetic characterization of vacA, cagA, babA2 and sabA. The chi-square or Fischer test were used to evaluate the association between each genotype and the clinical outcome. We found that 86.3% of the patients with precursor lesions of gastric malignancy presented the vacA s1/m1 genotype, 68.1% had the cagA+ genotype and 68.8% and 55.8% had the babA2+ and sabA+ genotypes, respectively. Our results show association between virulence genotypes and severe degree of polymorphonuclear cell infiltration. In addition, we found an association between the combination of vacA/cagA, vacA/sabA and babA2/sabA genes. This study provides evidence about the association of H. pylori virulence genotypes and gastric inflammation in infected patients.

Keywords:
Helicobacter pylori; Gastritis; Bacterial Adhesins; Virulence Factors; Inflammation

KEY MESSAGES

1. Motivation for the study.The high local prevalence of H. pylori and its genetic diversity are key factors for the development of digestive diseases. Identifying the virulent genotypes of H. pylori and their association with gastric precursor lesions, as well as histological parameters, could improve the understanding of its pathogenesis and severity of related diseases.
2. Main findings.The vacA s1/m1 genotype was more frequent in subjects with gastric precursor lesions. High polymorphonuclear cell infiltration is associated with vacA s1/m1, cagA+, babA2+, sabA+.
3. Implications. It is suggested that H. pylori genotypes influence gastric inflammation, contributing to the early prognosis of gastric preneoplastic lesions.

Keywords:
Helicobacter pylori; Gastritis; Bacterial Adhesins; Virulence Factors; Inflammation

INTRODUCTION

Helicobacter pylori (H. pylori) infection is a highly prevalent and significant condition in Colombia; however, not all infected patients develop severe disease such as atrophic gastritis, intestinal metaplasia, or gastric adenocarcinoma ¹1. Shahini Shams Abadi M, Ashrafi-Dehkordi K, Ahmadi R, Rahimian G, Mirzaei Y, Fereidani R, et al. Frequency of virulence-associated genotypes of Helicobacter pylori and their correlation with clinical outcome and histological parameters in infected patients. Heliyon. 2021;7(7):e07610. . doi: 10.1016/j.amjms.2020.07.030.
https://doi.org/10.1016/j.amjms.2020.07.... . This variability in disease severity and risk of malignancy suggests that genetic and virulence factors of H. pylori, along with host responses, play a critical role in the pathogenesis of these diseases ¹1. Shahini Shams Abadi M, Ashrafi-Dehkordi K, Ahmadi R, Rahimian G, Mirzaei Y, Fereidani R, et al. Frequency of virulence-associated genotypes of Helicobacter pylori and their correlation with clinical outcome and histological parameters in infected patients. Heliyon. 2021;7(7):e07610. . doi: 10.1016/j.amjms.2020.07.030.
https://doi.org/10.1016/j.amjms.2020.07.... .

The vacA gene of H. pylori is highly polymorphic, and its different variants have been linked to different levels of vacuolizing cytotoxin activity, which may influence clinical and histopathological findings in infected patients ²2. González-Vázquez R, Córdova-Espinoza MG, Escamilla-Gutiérrez A, Morales-Méndez I, Ochoa-Pérez SA, Armendáriz-Toledano F, et al. Frecuencia de genes de virulencia en infecciones mixtas con cepas de Helicobacter pylori de una población mexicana. Rev de Gastroenterol Mex. 2016;81(1):11-20. doi: 10.1016/j.rgmx.2015.10.001.
https://doi.org/10.1016/j.rgmx.2015.10.0... ^,33. Bakhti SZ, Latifi-Navid S, Mohammadi S, Zahri S, Bakhti FS, Feizi F, et al. Relevance of Helicobacter pylori vacA 3'-end Region Polymorphism to Gastric Cancer. Helicobacter. 2016;21(4):305-16. doi: 10.1111/hel.12284.
https://doi.org/10.1111/hel.12284... . Likewise, the cagA gene stands out as another important virulence factor of H. pylori, and strains carrying the cagA+ genotype are associated with increased gastric mucosal inflammation, cell proliferation and the appearance of gastric precancerous lesions ⁴4. Baj J, Forma A, Sitarz M, Portincasa P, Garruti G, Krasowska D, et al. Helicobacter pylori virulence factors-mechanisms of bacterial pathogenicity in the gastric microenvironment. Cells. 2021;10(1):27. doi: 10.3390/cells10010027.
https://doi.org/10.3390/cells10010027... .

The adhesion genes babA and sabA play an essential role in the early stages of the infection and inflammation process induced by H. pylori. These genes allow the bacteria to adhere to the gastric mucosa, initiating the colonization process. Evidence suggests that these genes are not only involved in the initial colonization, but also play a crucial role in the development of severe disease by participating in the induction of the immune response ⁵5. Doohan D, Rezkitha YAA, Waskito LA, Yamaoka Y, Miftahussurur M. Helicobacter pylori BabA-SabA key roles in the adherence phase: the synergic mechanism for successful colonization and disease development. Toxins. 2021;13(7):485. doi: 10.3390/toxins13070485.
https://doi.org/10.3390/toxins13070485... . The babA gene binds to Lewis B antigens facilitating initial colonization, while the sabA gene binds to Sialyl Lewis X antigens, which is relevant for the adherence to the inflamed gastric mucosa ⁶6. Chang WL, Yeh YC, Sheu BS. The impacts of H. pylori virulence factors on the development of gastroduodenal diseases. J Biomed Sci. 2018;25(1):1-9. doi: 10.1186/s12929-018-0466-9.
https://doi.org/10.1186/s12929-018-0466-... . Like babA and sabA, the vacA and cagA genes contribute to the expression and release of interleukin 8 (IL-8), macrophage inflammatory protein (MIP)-1α and (MIP)-1β by neutrophils, these H. pylori virulence factors are associated with increased polymorphonuclear neutrophil infiltration in areas of intestinal atrophy and metaplasia ⁷7. Gobert AP, Wilson KT. Induction and Regulation of the Innate Immune response in Helicobacter pylori Infection. CMGH Cell Mol Gastroenterol Hepatol. 2022;13(5):1347-1363.doi: 10.1016/j.jcmgh.2022.01.022.
https://doi.org/10.1016/j.jcmgh.2022.01.... .

Understanding the relationship between the genetic diversity of H. pylori and the host immune response in the context of virulence genes is essential to unveil the molecular basis of gastric diseases associated with this bacterium. This is fundamental to develop more precise and effective prevention and treatment strategies. Therefore, this study aimed to investigate the association between the variability of the virulence genes cagA, vacA, babA and sabA of H. pylori and gastric malignancy precursor lesions as well as histological parameters in Colombian patients.

THE STUDY

Study population

A descriptive cross-sectional study was conducted in 290 patients who attended the outpatient service of the Gastroenterology Unit from the Susana López de Valencia Hospital in the city of Popayán (located in southwestern Colombia), between February and December 2022. The sample was selected by convenience and included patients older than 18 years with dyspepsia symptoms and who were referred to gastric endoscopy during the last year. Patients with previous treatment of H. pylori infection with antibiotics or bismuth salts were excluded. Participants were divided into two groups: those with chronic gastritis and those with precursor lesions of gastric malignancy (atrophic gastritis and intestinal metaplasia).

Gastric biopsies and histopathology

We obtained five samples, two biopsies of the antrum (greater and lesser curvature), two of the body (greater and lesser curvature) and one biopsy of the angular incisure. The biopsies were fixed in buffered formalin and stained with hematoxylin-eosin and Giemsa stains. An experienced pathologist carried out the histopathological analysis of each specimen. Analogous visual scales were used according to the Sydney system ⁸8. Dixon MF, Genta RM, Yardley JH, Correa P. Classification and grading of gastritis: the updated Sydney system. Am J Surg Pathol. 1996;20(10):1161-81. doi: 10.1097/00000478-199610000-00001.
https://doi.org/10.1097/00000478-1996100... . We assessed the presence of inflammatory activity (inflammation by polymorphonuclear neutrophils) as well as the presence of chronic gastritis, atrophic gastritis and intestinal metaplasia. Additionally, two antrum and body samples were obtained for molecular analysis of H. pylori.

Detection of H. pylori vacA, cagA, babA2 and sabA genes

Bacterial genotyping was carried out by extracting DNA from biopsies using the Wizard Genomic DNA Purification extraction kit (Promega®, Madison, WI, USA) and following the manufacturer’s recommendations. The extracted DNA samples were stored at -30 °C until use. DNA quality was determined by A260/A280 absorbance ratio using a Thermo Scientific® NanoDrop 2000 TM spectrophotometer. The tests were carried out by biologists at the Human Genetics Laboratory of the Universidad del Cauca.

We used the QIAGEN Multiplex PCR® kit for gene amplification utilizing the following primers: vacA (VAI-F- ATGGAAATACAACAACAAACACACACAC; VAI-R- CTGCTTGAATGCGCGCCAAAC; VAG-F-CAATCTGTCCAATCAAGCGAG; VAG-R- GCGTCAAAATAATTCCAAGG) and cagA (cagA-F-GATAACAGGCAAGGCAAGCTTTTGAGG; cagA-R- CTGCAAAAGATTGTTGTTTGGCAGA); the amplification conditions were standardized as suggested by the kit manufacturer. The babA2 (babA2-F- CCAAACGAAACGAAACAAAAAAAGCGT; babA2-R-GCTTGTGTAAAAGCCGTCGT) and sabA (sabA-F- TTTTTTTGTCAGCTACGCGTTC; sabA-R-ACCGAAGTGATAACGGCTTG) genes were evaluated by conventional polymerase chain reaction (PCR) as suggested by Yadegar et al. ⁹9. Yadegar A, Mobarez AM, Alebouyeh M, Mirzaei T, Kwok T, Zali MR. Clinical relevance of cagL gene and virulence genotypes with disease outcomes in a Helicobacter pylori infected population from Iran. World J Microbiol Biotechnol. 2014;30(9):2481-90. doi: 10.1007/s11274-014-1673-5.
https://doi.org/10.1007/s11274-014-1673-... . H. pylori strains NCTC-11637, NCTC-11638, and clinical isolate 3062 were provided by the National Cancer Institute as positive controls. Amplification products were stained with 3 μL of EZ-vision (AMRESCO®) and analyzed by 1.5% agarose gel electrophoresis at 80 volts for one hour, visualized by UV transilluminator with a wavelength of 254/365 nm and compared with positive and negative controls. Pilot tests were carried out to verify the quality of the reagents and extraction kits, they also verified that the laboratory equipment had been previously calibrated.

Dependent and independent variable

The dependent variables were the precursor lesions of gastric malignancy, which includes atrophic gastritis and intestinal metaplasia, and histological parameters, such as the degree of polymorphonuclear cell infiltration and the degree of atrophy. Each of these histological variables was categorized into four severity levels: none, mild, moderate and severe. The independent variables were the H. pylori virulence genotypes, which included vacA, cagA, babA and sabA, and were measured as being present (+) or absent (-).

Covariates

We included other sociodemographic variables such as age in years, which was categorized into three groups (18-40 years, 41-60 years and ≥ 61 years); sex (men and women); income as the minimum living wage (MLW) (where < 1 MLW stands for less than a living wage and ≥ 1 MLW stands for greater than or equal to a living wage); place of origin (urban and rural); educational level of patients (none, primary, secondary and higher education).

Statistical analysis

Categorical variables were tabulated by using absolute and relative frequencies. The chi-square or Fisher test were used to compare H. pylori virulence genotypes with precursor lesions of gastric malignancy and histologic parameters. The SPSS version 25 software was used. Categorical variables are presented as proportions and absolute frequencies. Cramer’s correlation coefficient was used to determine the degree of association between genotypes. A value of p<0.05 was considered to be significant.

Ethical Aspects

Participants accepted to take part in the study and signed the informed consent form. This research was approved by the Ethics Committee for Scientific Research of the Universidad del Cauca. Act 6.1-1.25/5 of January 23, 2022.

FINDINGS

Population characteristics

We included 290 patients. Among the main demographic characteristics, we found that most participants were in the age group between 41 and 60 years, representing 45.2% of the sample. In addition, there was a marked predominance of the female gender, which constituted 73.8% of the participants. It is important to mention that 87.9% of the population had monthly incomes below the minimum wage. Regarding their geographic origin, 61.7% of the patients lived in rural areas. Most participants had only primary education (57.2%) (Table 1).

vacA, cagA, babA and sabA genotypes and precursor lesions of gastric malignancy

Our results show 217 participants who were positive for H. pylori by molecular diagnosis, of which 63.6% had precursor lesions of gastric malignancy (PLGM) and 36.4% had chronic gastritis (CG). The vacA s1/m1 and cagA+ virulence genotypes were more frequent in patients with PLGM with 86.3% and 68.1%, respectively. The vacA s2/m2 genotype was more frequent in patients with chronic gastritis. The frequency of babA2+ and sabA+ genotypes was higher in the population with PLGM with 68.8% and 55.8%, respectively; although there were no significant differences between patients with CG and patients with PLGM (p>0.05) (Table 2). Additionally, we evaluated the degree of association of the genes with each other. There was a significant correlation between the presence of the vacA gene and the cagA and sabA genes with a medium degree of association (VvacA/cagA= 0.359, VvacA/sabA=0.332), as well as between the sabA/babA2 genes (VsabA/babA2=0.506); however, no correlation was found between the other genes (Table 3).

vacA, cagA, babA and sabA genotypes and histological parameters

Considering the importance of the different H. pylori virulence genotypes on histological parameters, we determined that the allelic combination of the vacA s1/m1 gene, the cagA+, babA2+ and sabA+ genotypes are closely related to inflammatory activity, paarticularly to the severe degree of polymorphonuclear cell infiltration (p<0.05). In addition, we found a significant relationship between the presence of the cagA+ genotype and the occurrence of gastric atrophy in its most severe form (p<0.05). Other genotypes showed no relationship with the degree of atrophy (Table 4).

DISCUSSION

In this study we analyzed the presence of Helicobacter pylori vacA, cagA, babA and sabA genotypes and their association with gastric malignancy precursor lesions and histological parameters in infected patients from southwestern Colombia. We found that the s1/m1 genotypes of the vacA and cagA+ gene were more frequent in patients with PLGM, similar to previous studies in Colombia ¹⁰10. Carlosama-Rosero YH, Bolaños-Bravo H, Sierra-Tórres CH, Rosero EA. Asociación de los genotipos cagA, vacA e IceA de H. pylori con la gastritis crónica y folicular en una población colombiana con alto riesgo de cáncer gástrico. Rev Gastroenterol Mex. 2019;84(2):158-64. doi: 10.1016/j.rgmx.2018.03.004.
https://doi.org/10.1016/j.rgmx.2018.03.0... ^,1111. Martínez Leyva L, Montero González T de J, Piñol Jiménez FN, Palomino Besada A, Miranda Gómez O, Días Morejón D. Relación de los genotipos CagA/VacA del Helicobacter pylori con lesiones precursoras de cáncer gástrico. Rev Cub Med Mil. 2021;50(1):e0210729.. This finding suggests that the studied population has a high frequency of more virulent bacterial strains that could increase the risk of gastrointestinal diseases. The distribution of s1 and m1 alleles has been found to be associated with diseases such as atrophic gastritis, intestinal metaplasia, and high risk of gastric cancer ¹²12. Abdi E, Latifi-Navid S, Latifi-Navid H, Safarnejad B. Helicobacter pylori vacuolating cytotoxin genotypes and preneoplastic lesions or gastric cancer risk: a meta-analysis. Journal of Gastroenterology and Hepatology. 2016;31(4):734-44. J Gastroenterol Hepatol. 2016;31(4):734-44. doi: 10.1111/jgh.13256.
https://doi.org/10.1111/jgh.13256... . We found a relationship between the vacA virulence genes and the cagA and sabA genes, suggesting that these genes may act synergistically to increase gastric inflammation and the risk of developing PLGM. Our results show an increased frequency of babA2+ and sabA+ genotypes in PLGM, although there was no significant association. However, some studies in other countries have described that babA2+ and sabA+ strains are associated with increased risk of developing intestinal atrophy, intestinal metaplasia, and gastric cancer ¹³13. Kpoghomou MA, Wang J, Wang T, Jin G. Association of Helicobacter pylori babA2 gene and gastric cancer risk: a meta-analysis. BMC Cancer. 2020;20(1):1-7. doi: 10.1186/s12885-020-06962-7.
https://doi.org/10.1186/s12885-020-06962... ^,1414. Yanai A, Maeda S, Hikiba Y, Shibata W, Ohmae T, Hirata Y, et al. Clinical relevance of Helicobacter pylori sabA genotype in Japanese clinical isolates. J Gastroenterol Hepatol. 2007;22(12):2228-32. doi: 10.1111/j.1440-1746.2007.04831.x.
https://doi.org/10.1111/j.1440-1746.2007... . Differences between populations may be due to the small sample size, heterogeneity between studies, and geographic factors.

Ours is the latest study to explore the relationship between H. pylori virulence genotypes and histological parameters in a Colombian population. A previous Colombian study reported that strains with vacA s1 and m1 genotypes were closely associated with changes in gastric histology, while neutrophil infiltration, intestinal metaplasia and atrophy are significantly higher in babA2 gene positive cases compared to babA2 negative cases ¹⁵15. Yamaoka Y, Kikuchi S, El-Zimaity HM, Gutierrez O, Osato MS, Graham DY. Importance of Helicobacter pylori oipA in clinical presentation, gastric inflammation, and mucosal interleukin 8 production. Gastroenterology. 2002;123(2):414-24. doi: 10.1053/gast.2002.34781.
https://doi.org/10.1053/gast.2002.34781... . Studies from different countries have reported that inflammatory activity is more prominent in patients infected with strains harboring all virulent variants of H. pylori (vacA s1m1/cagA+/babA2+) ¹⁶16. Zambon CF, Navaglia F, Basso D, Rugge M, Plebani M. Helicobacter pylori babA2, cagA, and s1 vacA genes work synergistically in causing intestinal metaplasia. J Clin Pathol. 2003;56(4):287-91. doi: 10.1136/jcp.56.4.287.
https://doi.org/10.1136/jcp.56.4.287... . Also, colonization with virulence factors such as cagA+, iceA1-, and oipA+ has been found to correlate significantly with high polymorphonuclear cell infiltration, whereas colonization with cagA+, babA2+, and oipA+ is strongly related to higher mononuclear cell infiltration scores ¹1. Shahini Shams Abadi M, Ashrafi-Dehkordi K, Ahmadi R, Rahimian G, Mirzaei Y, Fereidani R, et al. Frequency of virulence-associated genotypes of Helicobacter pylori and their correlation with clinical outcome and histological parameters in infected patients. Heliyon. 2021;7(7):e07610. . doi: 10.1016/j.amjms.2020.07.030.
https://doi.org/10.1016/j.amjms.2020.07.... . The above findings are consistent with what was found by our study.

H. pylori infection causes local inflammation in the gastric mucosa due to migration and infiltration of immune cells, leading to disease progression. The cagA and vacA proteins produced by H. pylori stimulate a proinflammatory response leading to gastric inflammation. IL-8 production attracts immune cells to infiltrate the infection site, which favors a persistent inflammatory state ⁷7. Gobert AP, Wilson KT. Induction and Regulation of the Innate Immune response in Helicobacter pylori Infection. CMGH Cell Mol Gastroenterol Hepatol. 2022;13(5):1347-1363.doi: 10.1016/j.jcmgh.2022.01.022.
https://doi.org/10.1016/j.jcmgh.2022.01.... ^,1717. Gobert AP, Wilson KT. Human and Helicobacter pylori interactions determine the outcome of gastric diseases. Curr Top Microbiol Immunol. 2017;400:27-52. doi: 10.1007/978-3-319-50520-6_2.
https://doi.org/10.1007/978-3-319-50520-... . This may explain why the positive cagA and vacA status were related to polymorphonuclear cell infiltration in our study. The sabA+ genotype is also related to the induction of the inflammatory response leading to the development of gastric diseases. H. pylori sabA-positive strains stimulate neutrophil activation causing gastric epithelial damage ⁵5. Doohan D, Rezkitha YAA, Waskito LA, Yamaoka Y, Miftahussurur M. Helicobacter pylori BabA-SabA key roles in the adherence phase: the synergic mechanism for successful colonization and disease development. Toxins. 2021;13(7):485. doi: 10.3390/toxins13070485.
https://doi.org/10.3390/toxins13070485... . Our results show high polymorphonuclear cell infiltration in patients with the sabA+ genotype. These findings are consistent with other studies that show a relationship between sabA expression and gastric inflammation ¹⁸18. Petersson C, Forsberg M, Aspholm M, Olfat FO, Forslund T, Borén T, et al. Helicobacter pylori SabA adhesin evokes a strong inflammatory response in human neutrophils which is down-regulated by the neutrophil-activating protein. Med Microbiol Immunol. 2006;195(4):195-206. doi: 10.1007/s00430-006-0018-x.
https://doi.org/10.1007/s00430-006-0018-... .

By analyzing the adhesion genes babA and sabA, as well as the vacA and cagA genes, we can expand the evidence on their role in initial colonization, induction of immune responses and subsequent progression of gastric lesions. This research will contribute to fill the knowledge gap in the Colombian population and may have a significant impact on public health by identifying subgroups of patients at higher risk of developing severe gastric disease. The results of this study could provide valuable information to guide prevention strategies, early diagnosis and effective treatment in patients with H. pylori infection in Colombia and, possibly, in other populations with similar genetic characteristics.

One of the limitations of our study is the small number of patients included. In addition, we did not analyze other virulence factors of H. pylori that could be playing a role in mechanisms associated with the development of precursor lesions of gastric malignancy.

In conclusion, our findings show a high frequency of H. pylori vacA s1/m1 genotype in a Colombian population and the cytotoxic activity of this genotype could be enhanced by other H. pylori bacterial factors such as the presence of cagA+ and sabA+ genotypes. The vacA s1/m1 allelic combination is related to other H. pylori bacterial factors such as the presence of cagA+ and sabA+ genotypes. This study shows a relationship between the studied virulence genotypes and the degree of infiltration of polymorphonuclear cells, which play an important role in inflammatory activity, which could increase the progression of gastric malignancy precursor lesions. Further complementary studies, including negative H. pylori controls, are needed to strengthen this hypothesis.

Acknowledgements.

To the patients, the staff of the Hospital Susana López, the Andes del Sur Endoscopic Diagnostic and Surgical Unit, the Specialized Diagnostic Pathology Unit and the Human Genetics Laboratory of the Universidad del Cauca for their collaboration in the study.

References

Publication Dates

History